Feb. 25th, 2003

bored...

Feb. 25th, 2003 12:35 am
glitteringloke: (Default)
nothing much going on..
i have a paper to read for sr. sem tomorrow... don't know where it is, but i'll look for it in the morning... i have to magicly pull 9 bucks out of thin air for sariah... right... i can at least give her season 3 of sex in the city back...

i actually went in the lab for more research today.. its been a while.. but i'm back in it... right now its data analyzing... some of it looks really good, some, not so good. i printed some and i'll go highlighitng, but it'll be a royal pain in my ass... (its dna sequence... AGTCGATCCAGAGGCTTAGATGCAAG, etc..) lots of it....but it'll give me something to do in class....

i picked my topic for japanese... i'm looking at origami as my topic :) i have a page a day calander i can use for some samples ;) sweeeeeet.... gotta find something cute :) i guess i'll ATTEMPT to make the crane.... i suck at that.... maybe some boats...

i should start my paper for sr. sem... since its like 15 pgs long.... and i have nothing for research yet... :sigh: i'll get there...

right now i'm really anxious to get to ohio.... i can't wait for the 4am intellectual conversations :) it'll be sooo much fun... however, i'm not looking forward to the flight... i don't wanna sit in newark for a few hrs... blech.. and checking thru with my laptop... .sheesh....

lets see.... not much else is going on... just listening to music.. burning stuff off the HD and waiting for videowave to come in so i can redo my video. i'm thinking of uninstalling adobe premiere... it gives me nothing but headaches... maybe then i can totally redo the flcl vid and have it look actually good.... damn digitalized shiznit...

anyway... off to bore myself to sleep... or keep talking to the bestest friend in the world... ANNE!!

quizzes ;)

Feb. 25th, 2003 01:19 am
glitteringloke: (banana)
aaaahhhh!!! )

Profile

glitteringloke: (Default)
glitteringloke

Page Summary

March 2025

S M T W T F S
      1
2345678
9101112131415
161718 19202122
23242526272829
3031     

Most Popular Tags